| MadSci Network: Genetics |
As a child my parents had to get a DNA test done for some legal issues. All
these years later I'm very curious to see what it means. I've tried everything
that I can think of to decode this to no avail. The test was to compare
someone claiming to be my father against my DNA. The markers and the
corresponding numbers that go with them are:
CSF1PO 13,12
Vwn 18,17
D16S539 12,11
FESFPS 12
F13B 10,8
Hi Adrien,
As far as I can tell, at least 4/5 of these markers are Short Tandem Repeats (STRs). An STR is a sequence of a DNA molecule that has some short elements repeated a variable number of times. These markers are also called variable number of tandem repeats (VNTRs) or microsatellites.
The repeated elements in an STR are usually between 2 and 5 nucleotides long. For example, the DNA sequence, "ATCAATCAATCAATCAATCA" is an STR that consists of the sequence "ATCA" repeated 5 times. Another way to write this would be [ATCA]5.
The reason that STRs make useful markers is that the number of repeated elements varies widely between individuals, so that these sequences are highly polymorphic within the human species. If you look at multiple STRs that are found on different chromosomes, you can identify closely related individuals and distinguish unrelated individuals.
The number of repeats of the core element identifies the version (also known as an allele) of the STR that a person has. So the example that I provided above would be allele 5 of an ATCA repeat. Since everyone has two copies of most nuclear chromosomes (except for the X and Y chromosomes in men), each person can have up to two different alleles. Hence, the two numbers following the names of the STRs in your report.
In the examples that you provided, CSF1PO, D16S539, FESFPS and F13B are STRs. I'm not sure what Vwn is, but it may the STR known as vWA. VWN is an abbreviation sometime used to refer to von Willebrand Factor, and the vWA STR ins a von Willebrand Factor STR. I've included some information about each of these STRs below; this comes from the National Institute of Standards and Technology's STR database. The numbers that follow each name identify which alleles you have. So "CSF1PO 13,12" means that you have alleles 12 and 13 of the CSF1PO STR. The core repeated sequence for that STR is "AGAT", so you have twelve repeats of AGAT on one copy of chromosome 12, and thirteen repeats on the other.
| STR name | Repeated Element | NIST entry | Chromosomal Location | Gene information |
| CSF1PO | AGAT | http://www.cstl.nist.gov/strbase/str_CSF1PO. htm | Chromosome 5q33.1 | human c-fms proto-oncogene for CSF-1 receptor gene, 6th intron |
| vWA | TCTA & TCTG (two elements repeated) | http://www.cstl.nist.gov/strbase/str_VWA.htm< /a> | Chromosome 12p13.31 | von Willebrand Factor, 40th intron; 5.963 Mb |
| D16S539 | GATA | http://www.cstl.nist.gov/strbase/str_D16S5 39. htm | Chromosome 16q24.1 | 84.944 Mb |
| FESFPS (FES/FPS) | ATTT | http://www.cstl.nist.gov/strbase/str_fes.htm | Chromosome 15q25-qter | human c-fes/fps proto-oncogene |
| F13B | AAAT | http://www.cstl.nist.gov/strbase/str_f13b.htm< /a> | Chromosome 1q31- q32.1 | human blood coagulation factor XIII b subunit gene |
As for what the meaning of your results is, that largely derives from the results of others to which they are compared. What these results give you is some limited insight into some of the gene variants that distinguish you from others. Some of these STRs are found in specific genes, but I don't know to what extent these data tell you anything about the functions of those genes.
Try the links in the MadSci Library for more information on Genetics.